top of page
aws.jpg

Coat Color Genetics

A brief introduction to the genes that control coat color in Siberians

Currently, there are 15 separate genes that control coat color and pattern in dogs. They play a role in the color, amount and distribution of melanin pigments. Four major genes, E (MC1R), A (ASIP), K (CBD103), and B (TYRP1), control the relative levels, type and color of pigment, whereas other genes, such as I (MFSD12), S (MITF), D (MLPH), and M (PMEL17), control the distribution of pigment. All of these genes with the exception of PMEL17 (which gives the merle phenotype) cause coat color variation in Siberians. For an excellent, more in-depth review of canine coat pigmentation genetics, see here.

The E locus (MC1R gene)

This gene codes for a receptor protein that signals when a pigment cell should make black/brown (eumelanin) or red (pheomelanin) pigment. Mutations in this gene either increase (Em), decrease (eA) or prevent (e1 or e3) eumelanin production in the coat. 

The alleles at this gene found in Siberians are:

  • Em (Melanistic Mask): Dogs with this allele have increased eumelanin and generally display a black (or brown) mask on the face covering the nose and mouth, and sometimes over the eyes. This allele is dominant over E, eA and e such that heterozygotes will have a melanistic mask.

  • E (wildtype): Dogs with this allele have an average amount of eumelanin in their coat. E is dominant to eA and e.

  • eA (ancient red aka domino): Dogs with this allele have decreased eumelanin in their coat and generally have an increased amount of pheomelanin on the face (including larger "eye brows") and undercoat. This allele is responsible for the characteristic white mask found in the breed. It is dominant to e.

  • e1 and e3 (recessive red): Dogs with these alleles can only make pheomelanin in their coats and are generally cream to white in this breed.

 When thinking about different alleles, it's helpful to consider the actual mutations to the DNA sequence causing these different phenotypes to understand why the function of the gene product, and hence the phenotype, is affected. To show this, I will include the entire coding region of the MC1R gene below and highlight the different mutations that define these different alleles in different colors.:

ATGTCTGGGCAGGGCCCCCAGAGAAGGCTGCTGGGCTCTCTCAATGGCACCTCCCCAGCCACCCCTCACTTCGAGCTGGCTGCCAACCAGACCGGGCCCCGGTGCCTGGAGGTGTCCATTCCCGACGGGCTGTTCCTCAGCCTGGGGCTGGTGAGCGTTGTGGAAAATGTGCTGGTGGTGGCCGCCATTGCCAAGAACCGCAACCTGCACTCGCCCATGTATTACTTCATCGGTTGCCTGGCTGTGTCCGACCTGCTGGTGAGCGTGAGCAATGTGCTGGAGACGGCCGTCATGCTGCTGGTGGCGGCAGGCGCCTTGGCTGCTCAGGCTGCTGTGGTGCAGCAGCTGGACGACATCATTGACGTGCTCATCTGTGGTTCCATGGTATCCAGCCTCTGCTTCCTGGGCGCCATTGCCGTGGACCGCTACCTCTCCATCTTCTACGCGCTGCGATACCACAGCATCGTCACACTCCCGCGGGCGTGGCGGGCCATCTCCGCTATCTGGGTGGCTAGCGTCCTCTCCAGCACGCTCTTCATTGCCTACTACAATCACACGGCCGTCCTGCTTTGTCTTGTCAGCTTCTTTGTAGCCATGCTGGTGCTCATGGCAGTGCTGTACGTCCACATGCTTGCCCGCGCCTGCCAGCACGCCCGAGGTATTGCCCGGCTCCATAAGAGGCAGCACTTCATCCCCCAGGGCTTTGGCCTCAAGGGCGCTGCCACACTCACTATCCTGCTGGGCATTTTCTTTCTCTGCTGGGGCCCCTTCTTCTTGCACCTCTCACTCATGGTCCTCTGCCCTCAACACCCCATCTGTGGCTGCGTCTTTCAGAACTTCAACCTCTTCCTCACCCTCATCATCTGCAACTCCATCATTGACCCCTTCATCTACGCCTTCCGCAGCCAGGAGCTCCGAAAGACTCTCCAAGAGGTAGTGCTATGTTCCTGGTGA

In the sequence above, the four mutations in this gene found in Siberians are shown in red (eA), purple (Em),  blue (e1) and green (e3). The eA mutation is a cytosine to thymine transition, the Em mutation is an adenine to guanine transition, the e1 mutation is a cytosine to thymine transition, and the e3 mutation is a two basepair (CT) deletion. Because this gene makes a receptor protein located in the cell membrane, it is likely that these mutations interfere with the binding of the ligand that signals the inside of the cell to make eumelanin. It is interesting to note that the e mutations (including e1 and e3) likely prevent cell signaling, while the eA mutation just reduces it. Of course there is more to this story as there are other signaling proteins that bind with this receptor too, such as ASIP described below. ASIP interacts with these different E locus alleles to create a different phenotype as summarized in Figure 1.

effect of domino.png

Figure 1: The effect of eA, aka as domino, combined with different A locus genotypes. Designed by Corinne Benavides-Gyger. 

The A locus (ASIP gene)

This gene codes for a signaling protein that interacts with the MC1R receptor to disrupt eumelanin and stimulate pheomelanin production. Although we still use the alleles Ay, aw, at and a, and will continue to use them on this website since that is what most people are still familiar with, it was recently discovered that the mutations that are being used to test for these alleles were simply linked to causative mutations found in two different promoter regions (known as the Ventral Promoter, or VP, and the Hair Cycle Promoter, or HCP) in the ASIP gene. Canids have been found to have two different transcriptional start sites with 2 different VP haplotypes (VP1 and VP2) and 5 different HCP haplotypes (HCP1-5), and different configurations result in different colors/patterns. These different configurations perfectly explain the various A locus phenotypes observed in dogs (see figure 2 below). 

New designations for these alleles are described as:

  • Dominant Yellow DY (formerly clear sable, Ay): Dogs with the VP1 and HCP1 haplotype (figure 2) have a mostly pheomelanin coat with very little eumelanin. These dogs will appear white/cream/yellow/red with a very small amount of black tipping in the breed. The shade of pheomelanin is controlled by other interacting genes.

  • Shaded Yellow SY (formerly shaded sable, Ay): Dogs with the VP2 and HCP1 haplotype (figure 2) have mostly a pheomelanin coat with more black tipping compared to a dominant yellow dog. These dogs may appear white/cream/yellow/red with small to moderate amount of black tipping on the back in this breed. The shade of pheomelanin is controlled by other interacting genes.

  • Agouti AG (formerly aw): Dogs with the VP2 and HCP2 haplotype (figure 2) have a banded yellow and black coat, but the amount and shade of pheomelanin vs eumelanin is controlled by other interacting genes (e.g., eA will increase pheomelanin and decrease its intensity). These dogs may appear anywhere from light silver with minimal black tipping on a white coat when this allele is combined with eA and low intensity, to dark agouti with heavy black tipping over a yellow/red coat when combined with Em and high intensity, for example.

  • Black Saddle BS (formerly saddleback or creeping tan): Dogs with the VP1 and HCP3-5 haplotype (figure 2) are born with more eumelanin but the black pigment slowly recedes to cover only the back area as the pheomelanin pigment increases.

  • Black Back BB (formerly tanpoint, at): Dogs with the VP2 and HCP3, 4 or 5 haplotype (figure 2) have a black back with tan points (black dorsal hairs and tan hair on cheeks, eyebrows, and back legs). In Siberians, the tan may range anywhere from a deep red to white color depending on the alleles present at other genes. Note that many DNA testing companies cannot test for the HCP5 haplotype at this time and by default return aw on dogs with this haplotype. HCP5 is common in Siberians. Notably, Zhokhov, the 9500 year old Siberian dog that was discovered a few years ago in the eastern Siberia, is VP2 and HCP4 — a tanpoint (aka black and white in Siberians), providing evidence that this mutation is ancient and may have been selected for by humans to help differentiate dogs from wolves. 

  • Recessive black, a: Dogs with two loss of function mutations at this gene are solid black (if E or Em) or have increased eumelanin if eA- resulting in a darker coat than expected for a domino dog. Although rare, this allele does occur in Siberians.

This allelic series may show some codominance, but generally the order of dominance for these alleles is:  DY > SY > AG > BS > BB1, BB2, BB3 > a.

Dog ASIP Haplotypes, with study allele names.png

Figure 2: Summary of how extended haplotype combinations are related to color pattern phenotypes. Designed by Corinne Benavides-Gyger. Data from Bannasch et al 2021.

Urajiro (unidentified gene)

An allele at this minor color gene appears to dilute areas of pheomelanin pigment on the undersurface of the dog only (muzzle, chest, belly, inside of hips, underside of tail) causing these areas to lighten to cream to white in the Siberian. 

The K locus (CBD103 gene)

Also known as dominant black. This gene makes a β-defensin protein that, in addition to potentially causing black coat color, also plays a role in innate immunity and wound healing.

 

There are two known alleles for this gene:

  • ky is wildtype and does not interfere with ASIP binding.

  • KB is known as CBD103ΔG23 and lacks a glycine amino acid at the beginning of the protein, which can bind with higher affinity than the ky allele to MC1R on the surface of melanocytes. Due to its binding affinity and high expression levels, Kb is thought to displace ASIP allowing MC1R to signal unabated, leading to the synthesis of the black pigment eumelanin and resulting in a black/brown coat color that can range from solid black/brown to a banded agouti-like coat depending on other genes (e.g., the presence of two copies of eA will cause a banded, agouti-type color).

 

Both KB and ky alleles make proteins that are potent antibacterial peptides with nearly equal antibacterial activity in the skin of dogs, but research is ongoing since the canine gene is very similar to the human gene and may serve as a model for studying human β-defensin biology.

The B locus (TYRP1 gene)

This gene makes an enzyme that converts brown into black pigment. Null mutations in the gene result in brown (known as red in Siberians) eumelanin. There are at least 5 known alleles that result in a non-functional protein.  The alleles that may be found in Siberians include:

  • B is wildtype and allows the normal production of black eumelanin.

  • b are null mutations. Lacking TYRP1, eumelanin does not undergo final conversion from brown to black pigment.

    •  bd (most common): deletion of a proline residue in exon 5

    •  bc: point mutation S41C (serine replaced by cysteine)

    •  bs (rarest in all breeds but most common in Siberians): premature stop codon in exon 5

    •  bh (found only in a single lineage of Siberian huskies): point mutation 125G>A (cysteine replaced by tyrosine) in exon 1 (see figure 3 from Van Buren et al. 2021)

bh.png

Figure 3: A novel b allele found in a single family of Siberian Huskies. The bh variant is thought to be a result of a recent de novo mutation. Van Buren et al 2021

I locus (MFSD12 gene, + 4 others)

Pheomelanin intensity appears to be a continuous trait with many genes contributing to the range in intensity that we see from red to cream to white. We now understand at least 5+ separate loci contribute to this phenotype and explain over 70% of the variation. In addition to KITLG and MFSD12 genes, this new study found three additional loci that contribute to pheomelanin (red/yellow/cream) pigment intensity. Those new genes include Tyrosinase (TYR), SLC26A4, and a lincRNA that may regulating the RUNX gene. Together, these 5 loci explain over 70% of range in pheomelanin intensity that we see in dogs. They also found how these loci interact (whether they can mask each other or work together in an additive manner). It appears that MFSD12, which is the gene formally called the I locus, is epistatic to KITLG and SLC26A4. What this means is that if MFSD12 has two copies of cream, ii, (which many Siberians have), it doesn't matter what is at those other two loci as MFSD12 masks them. They also found that more red intensity is partially dominant over cream for TYR, SLC26A4, and MFSD12, and cream intensity is dominant at KITLG.

The dominant I allele at MFSD12 is not common in Siberians as the vast majority of Siberians are homozygous ii at this gene resulting in white/cream pheomelanin. When the dominant allele is present, the pheomelanin is red or yellow, especially if the dog is E or Em. Figure 4 shows phenotypic expression of high, medium and low intensity pheomelanin across different A locus alleles and in ee dogs.

 

Previously, the presence of the dominant I allele was called "sable" in Siberians because of the red intensity, however this is an inaccurate use of this color description since the intensity of the red pigment has nothing to do with whether the dog is a genetic sable with the Ay (VP1 or VP2 with HCP 1) or not. In fact, many genetic sable Siberians are cream in color (due to being ii at MFSD12) with a small to moderate amount of black tipping.

 

Note that domino (eA) also decreases the intensity of pheomelanin even if the dog has a copy of the dominant I allele at MFSD12

A locus alleles with intensity.jpg

Figure 4: Summary of high, medium and low intensity across A locus alleles and ee.  Designed by Corinne Benavides-Gyger. 

S locus (MITF gene)

The piebald or white spotting phenotype is due to a defective transcription factor made by a gene known as MITF. This transcription factor acts as a messenger regulating pigment cell survival and migration. When pigment cells are absent, we see white spotting. The piebald phenotype appears to be a nice example of mutation accumulation with several mutations (sine insertion, 12bp deletion in exon 1B, long length polymorphisms in the promoter, etc.) acting in an additive manner to reduce the transcription of MITF (the more mutations, the more white due to less melanocyte survival/migration). Since wolves and many northern breeds have the SINE insertion mutation, they test sp/sp using commercial lab DNA tests even though many have no white spotting. It is likely that they do not have the other mutations associated with this phenotype and the sine insertion alone is not enough to prevent pigment cell migration causing the white spotting phenotype. Note that DNA testing companies are only testing for the SINE insertion in this gene, which has around a 70% frequency in Siberians, but this insertion alone is NOT causative of the piebald phenotype in this breed. While all piebald Siberians likely test sp/sp, not all sp/sp Siberians are piebald.

D locus (MLPH gene)

This gene codes for a protein known as melanophilin which is involved in the transport of pigments. The mutations that cause the dilute phenotype cause an abnormal clumped distribution of both eumelanin and pheomelanin (Figure 5), which makes black appear blue, brown appear lilac, and may also make red appear cream.

There are at least 3 alleles that cause this phenotype, however only the first has been found in Siberians (mainly in a single, old racing lineage) at this time.

  • D is wildtype and leads to pigment being evenly distributed throughout the hair shaft.

  • d1 is an ancient null mutation found in many breeds including Siberians. It causes a clumped distribution of pigment in the hair.

In some dogs, coat color dilution is associated with hair loss and recurrent skin inflammation, also known as color dilution alopecia (CDA).  There is no evidence of this occurring in Siberians at this time; however, there are very few dilute Siberians.

Picture8.png
image0 (2).jpeg

Figure 5: (Left) Normal  distribution of pigment compared to the abnormal, clumped distribution caused by the dilute variant. (Right) A dilute black (blue) Siberian.

Siberian Husky Genetics

Many thanks to all of the contributors to this website which include breeders, owners and photographers from around the world. 

 

Created by: Tracy Smith, PhD

tsmithwintersrun@gmail.com

©2022-25 by Siberian Husky Genetics. Proudly created with Wix.com

bottom of page